Given a sorted linked list, delete all nodes that have duplicate numbers, leaving only distinct numbers from the original list. For example, Given 1->2->3->3->4->4->5, return 1->2->5. Given 1->1->1->2->3, return 2->3. Solution: /** * Definition for singly-linked list. * public class ListNode { * int val; * ListNode next; * ListNode(int x) { val = x; } * } */ public class Solution { public ListNode deleteDuplicates(ListNode head) { ListNode dummy

Suppose a sorted array is rotated at some pivot unknown to you beforehand. (i.e., 0 1 2 4 5 6 7 might become 4 5 6 7 0 1 2). Find the minimum element. You may assume no duplicate exists in the array. Solution 1: public class Solution { public int findMin(int[] nums) { int lo=0, hi=nums.length-1; while(lo<=hi){ int mid = lo + (hi-lo)/2; if(nums[lo]<=nums[hi]){ break; } else { if(nums[mid]>=nums[lo]){

Given two strings s and t, determine if they are isomorphic. Two strings are isomorphic if the characters in s can be replaced to get t. All occurrences of a character must be replaced with another character while preserving the order of characters. No two characters may map to the same character but a character may map to itself. For example, Given “egg”, “add”, return true. Given “foo”, “bar”, return false.

Given an array of non-negative integers, you are initially positioned at the first index of the array. Each element in the array represents your maximum jump length at that position. Determine if you are able to reach the last index. For example: A = [2,3,1,1,4], return true. A = [3,2,1,0,4], return false. Solution: public class Solution { public boolean canJump(int[] nums) { int max = 0; for(int i=0; i<nums.length; i++){

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: “ACGAATTCCG”. When studying DNA, it is sometimes useful to identify repeated sequences within the DNA. Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. For example, Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", Return: ["AAAAACCCCC", "CCCCCAAAAA"]. Solution: public class Solution { public List<String> findRepeatedDnaSequences(String s)

Given a pattern and a string str, find if str follows the same pattern. Here follow means a full match, such that there is a bijection between a letter in pattern and a non-empty word in str. Examples: pattern = "abba", str = "dog cat cat dog" should return true. pattern = "abba", str = "dog cat cat fish" should return false. pattern = "aaaa", str = "dog cat cat dog" should return false.

Given preorder and inorder traversal of a tree, construct the binary tree. Note: You may assume that duplicates do not exist in the tree. Solution: /** * Definition for a binary tree node. * public class TreeNode { * int val; * TreeNode left; * TreeNode right; * TreeNode(int x) { val = x; } * } */ public class Solution { public TreeNode buildTree(int[] preorder, int[] inorder) { return

Design and implement a data structure for Least Recently Used (LRU) cache. It should support the following operations: get and set. get(key) - Get the value (will always be positive) of the key if the key exists in the cache, otherwise return -1. set(key, value) - Set or insert the value if the key is not already present. When the cache reached its capacity, it should invalidate the least recently used item before inserting a new item.

Given inorder and postorder traversal of a tree, construct the binary tree. Note: You may assume that duplicates do not exist in the tree. Solution: /** * Definition for a binary tree node. * public class TreeNode { * int val; * TreeNode left; * TreeNode right; * TreeNode(int x) { val = x; } * } */ public class Solution { public TreeNode buildTree(int[] inorder, int[] postorder) { return

Given a string S and a string T, find the minimum window in S which will contain all the characters in T in complexity O(n). For example, S = “ADOBECODEBANC” T = “ABC” Minimum window is “BANC”. Note: If there is no such window in S that covers all characters in T, return the empty string “”. If there are multiple such windows, you are guaranteed that there will always be only one unique minimum window in S.