Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: “ACGAATTCCG”. When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

Solution:

public class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
        Set<String> appeared = new HashSet<>();
        Set<String> repeated = new HashSet<>();
        List<String> ans = new ArrayList<>();
        for(int i=0; i<s.length()-9; i++){
            String seq = s.substring(i,i+10);
            if(!appeared.add(seq) && repeated.add(seq)) ans.add(seq);
        }
        return ans;
    }
}